DC900080

Overview
NameDC900080
Unique NameDC900080
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length648
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900080_ssr145 microsatellite DC900080_ssr145:145..159.
Csv1_Contig4151 contig Csv1_Contig4151:23..685. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionDC900080 VSS Citrus sinensis cDNA clone VS27Q87 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900080 ID=DC900080|Name=DC900080|organism=Citrus sinensis|type=EST|length=648bp
CCCTAATAGTAAGCAATGGCAAAGCTCGCTCTCCTTCTAGCTACCTTTAC
ACTCCTCTTCCTCATTGCCAGCGCCTCCATTTATCGCACCACCGTCGAAG
TCGACGAAGAAAACCCTCGGGGACAGAGCTGCCAGGAGCAGTTCCAGCAG
CAGCAGCAGCTTAGGCACTGCCAAATGTTCTTGAGGCAGCAGAGCCAGGG
GGGAGCATGGGACAACCAGCAGCAACACCTTCGTGAATGCTGCAGGCAGT
TGCAGCAATTGGAAACCAGATGCCGCTGCCCGGGACTTGAGCAAGCCGTG
AGACGCCAGCAGCAACAGGGACCGTTCGGCGAACAGCAGGAAATGTTTGA
AACGGCAAGTGAAATCCCTCGCATGTGCCAAATGCAGCCCTTGAGGGGTT
GTGACTTCCGCTCACTTTACACGTCCTTTTGAAGTAGATTAATTATAAGG
TGATCGTGTGATGGCCGGCGCTTAGAGATGATGAAGAGGTGTATAGAGTC
TTATGTGTAGATAGCAATAAAGCTGATCACTTGTGCTCTAGCATTTTGGC
TGGAGATTTGCGTGATTAGCTGGCCAGTATCTAATAACAAGATTTGGTGA
GTGAATGTATGTAATAATCTAAGCATCTTTAATAAAAGTTTCAGTTTT
back to top