DC900079

Overview
NameDC900079
Unique NameDC900079
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length704
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DC900079_ssr212 microsatellite DC900079_ssr212:212..226. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig5931 contig Csv1_Contig5931:4..707. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900079 VSS Citrus sinensis cDNA clone VS27Q86 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900079 ID=DC900079|Name=DC900079|organism=Citrus sinensis|type=EST|length=704bp
CTGCCACCCTCTCTTATTTTGCATGCTCTCGGCTCTCCTCTTTTTAACTC
TTCATCTCCTTTTCGTTCTCTCTTCTCTTTCAACCAAAGCCTTAACAAAG
CACACCAAAACCAAAAAATCGCATTTTTTTTTCTTTTCATCTTCAAATAT
GGCGGTTGAAGCTAGACGCATAGACCTTCTCCCTTCGCAATTAATCTCAC
ACAGAGATTTTATCAAATCAAATCAAGTAAACGCCAATACCCAGATGGAT
TCTTTCTTTCCTTTTGCTGAACCAATGCCTGAACAAACTATGTTACCATT
CTATCAAGCCTTCGATTGCAATCCGATTTCTACTAAAACGTCAATGGACA
AAGCTGATAGCGGGCTCACGTACAATATTCCCGCACCAAGAAAGCGCCAA
AGAGATTCAATCAACGATCTTGATGCCTTCTCCCTTGTCTCTCAAAAGCA
AAAGCTCTCTGGCTTCTCGTCTTTACTTGATCAAGACATCATCTTTCGGT
TGCAACAACAGCAGTCCGAAATCGACCGTTACATTGCCCAACATACGGAG
AAAGTGATATTGGAACTTGAAGAACAGAGGAAGAGGCAATCAAGAATGTT
AATATCAGCAATCCAAGAAGGAGTGGCCAATAGGTNAAGGAAANGACGAA
GAGATTCATAGATGNGGAACTCAACTGGGTTCTTAAGAAGAGTAAAAGTT
ATTT
back to top