CN185885

Overview
NameCN185885
Unique NameCN185885
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length813
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12286 contig Csv1_Contig12286:422..1234. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Properties
Property NameValue
Genbank descriptionUCRCS05_0002A07_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002A07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185885 ID=CN185885|Name=CN185885|organism=Citrus sinensis|type=EST|length=813bp
GGCCGCTGAGTTTTTTTTTTTTTTTTAGCGACCCAATAATGCTTTGAATT
TTCTCAACCTTTGACAGGTCCCTTACAAATGTCAACATAGTGTTGAACAC
TTCCAGCTACAGGAGTCGTAGAGAAAATGAAAGAAATGGACATAAAAGTC
CAACAAAGGATCACATAAATCACACAGTTCCAATTACTAACAACAGTAAT
GGCATTAATATTGGGCTAGACCATAACCCACATTGGTCCACAGCAGACTG
TGAGTCGCCCGGGTTTATTCACACTCGTCTAGCAAAGGGAAACGAGAGTT
TCAATAACATATGGTACAGAGGTAACATTATTTCTGTCTAATACACATGG
CTAAGCCTCATAAGAACAAGTTCAGATCATAATTGGTTGGTATCCATCTT
CGTACTTATTCCTACGCCTGTAACCCACAGCGGCAGCAATGACAGCAACT
CCGGCTAAAACAAATGCTCCCCAAACAAAAGCAGAATGGTTTATATCACT
GTCCATCTTGTTGAAAACATCTAAGAATGAACTGGACTCGGGCACCCTGT
CTGCAACCAAAATGTAGAAAAGCCCCATGACTCCTGTGTGTTCGCGGGAG
CTACTATAGCTAGATTCCACAATCAGAGTTTCCCCATCTGTTATCCTGAG
GGAGCCTGGTTTAGGATAACAGGTCGACATTCCTACAATATATCCAGCCT
CGTTTCCAGCTTCCATCCCATTTCCATAAGCTGGAATTGAAGAGCACATA
AGTTGTCCATCCTCTCTGTATAGAGCTGCACCAATGCCCCCTGAGTGCTG
ATGGGCAACGCCA
back to top