DC900076

Overview
NameDC900076
Unique NameDC900076
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length602
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11941 contig Csv1_Contig11941:20..621. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionDC900076 VSS Citrus sinensis cDNA clone VS27Q82 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900076 ID=DC900076|Name=DC900076|organism=Citrus sinensis|type=EST|length=602bp
GATCTATTTGTCTGCAAATCTTCTCATAGTTATATCACCAAAGGAAAACG
AAAAATGTCTGGCTGTGGTGGAAACTGTGGCTGTGGTTCTAGCTGCAAGT
GCGGCGGCGGCTGCGGCGGTAGCTCCATGTACCCTGACTTGAGATCCTTT
GAGAGCACCACCGTAGCCACCGAGACCCTCGTCCTCGGTGTTGCTCCTGT
CAAGATGCACTCTGAGGGGTCCGAGATGGGATTCGGAGCCGAGGGCGGCT
GCGGCTGCAAGTGTGGACCAAACTGCAAGTGCGACCCTTGTAACTGTTAA
TGAAGACTACGAGACGTGAACATGCCCCAGAATAAAGCAGCGCTGTGAGG
TCGTTTAAATTATAGTATCAATAAAAAGAACTATTTATCGTTTGTGGTTG
GCTTTGTTGGATGTCGTTTTATGAGCTTTTGTTTGTAAAATAAAAACCAG
CCATGGCTGCTTCTCCGAATCCTTAACTGGGTCTGTTGCAGATCCATGGC
TAGTTAATTAATCATTAAGTGTCTCTGTGACTTTGTGTACGAGCGTATCT
GTTACTGCTGCTATTCTAATGGGAAGCTTCCTCTCAGACTTTTATCTATA
TT
back to top