DC900075

Overview
NameDC900075
Unique NameDC900075
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length638
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13640 contig Csv1_Contig13640:32..671. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900075 VSS Citrus sinensis cDNA clone VS27Q81 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900075 ID=DC900075|Name=DC900075|organism=Citrus sinensis|type=EST|length=638bp
TCTCTTTGACTCACCCGCTCTGTCCCTCTCACTCTCACCCACGAAGCTCG
TTCCCCTCTCACTCACCCACAAGCTCGCTGTCAATATTTTGCTCAGATCT
CAGCTAACGCATCATCAAAACTGCAACCATGATGCTAGGCTGAGGAGGAT
CCAATGTCGTGGATCATTGTTGGATGCCGAATCAGCATACAATGCTTACA
ATTGTGAGAGAAAAATGAACAACCAATTGCCCAGTTCAGTTACGCTTTAA
GCTAGGAAGATTGACGTAGAAACATTTGTTTAAGTGTAATTACCTAGGTA
GGTGAAAAAGGTCCAAAATCGTCAAGCACACTGTCAACTAAGGCTGGTCG
GCGACGTGAACGGCGTGATAGCGATGTCGGTGATGGGCTGGTCGGCGATG
GGCGTGGCGTGACAACAAGTTTCGTGGGTGAGTGACAGCCTGAGAGAAAT
AGCTCGCAAGTGGGTGAGTGAGAGAGGCAGATCGGGTGAGTGAGAGAGAC
AGAGCTGGTGAGTGAGAGGGAAGGTGAATGAGAGAGACAGAGCAAGCGAG
TGAGAGGGACGGGTAAGAATTTTGGATTTTTCAAATTCTTTAGATTTAAT
TTTAATATTTTTCAATGGTAAAATCTATTTTTAATTTT
back to top