DC900068

Overview
NameDC900068
Unique NameDC900068
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length446
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900068_ssr422 microsatellite DC900068_ssr422:422..445.
Csv1_Contig7124 contig Csv1_Contig7124:1294..1739. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900068 VSS Citrus sinensis cDNA clone VS27Q73 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900068 ID=DC900068|Name=DC900068|organism=Citrus sinensis|type=EST|length=446bp
GGGGATATCAATTCCGCAGAAACAACACAATGACAAAACTTCTGAGCCGA
TTCAGATGAAACCGAACCACCTCAAGNATCAATACAAACAAAGACCATAA
CTATTAATAATATTGAGACTCCAGGTTAGAGCTGCGCCACCNTNTGTCAA
GCACCCAATTCTGGGAATCGGTACCCGACACCAAAGGCAACAAACTAAAA
CCTACAAAGGAAAGCAAGCATCGAACTATAACAGNACCAAAAATAACCAA
GTTTGTATAACTACAATTATTAAAATAGACTCCATCTGCGGATAAAGCAA
CATTAACCAACCCGATTCACTTCTTCTTGGCTGCAGACTTGGNGACCTTG
GCACCTGATGGATCCTTCCTCGNGCCGAATTCGGCACGAGCGGCACGAGC
TCGNGCCGAATTCGGCACGAGCTCTCTCTCTCTCTCTCTCTCTCTC
back to top