CN185870

Overview
NameCN185870
Unique NameCN185870
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length576
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN185870_ssr271 microsatellite CN185870_ssr271:271..282. BLAST: Citrus ESTs to Populus V2 proteins
Csv1_Contig2516 contig Csv1_Contig2516:136..711. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0001P23_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001P23, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185870 ID=CN185870|Name=CN185870|organism=Citrus sinensis|type=EST|length=576bp
TTTTTTTTTTTTTTTTTATCAGGAACACCATGTTCACTTCATTAATTTAA
CAAAATTTTATTGGGAAAAAAAAACAAAAACAACAACAAGAAATCAACAA
CAAAAAGAGTAAAGAGTATTTTACGCGACGTCTTTGATTCTTGCAACTTT
TGTAATTAACATAGAAAACGAAATGACCAAGAAGAGGCGCGCCGCACGGT
CATTTTTTGTGTGAAAGGGCTTGATAATAAGTACAAATGAATCAAACAGC
AACAGCACATCCATCATCAGTATTATTATTATCGTTATGCTGCTGCAGCT
GGAGACCACTAGGAACTTCTAAGCTTTTCGGATTTCTTTGATCGGTCTCC
TGATGATTCTCTTTTGGTCCTTGGTTAACATCAGTAGTGTCAGCATCATC
AGGATGAATATCAACCGGGTACACTTCAGAAGCTCCTAAATTGCTCAGTA
CTACAATGCTCTTTAACTGGGCTTCTGGAAATTTTTTTTCCTCTATTATA
ACTTTGTTGGCGTTCTTGCATATCACATAAAGCAACATTTGAGTCAATCC
TAAGAGGAACCCCACGATATTCGGGA
back to top