DC900066

Overview
NameDC900066
Unique NameDC900066
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length400
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3987 contig Csv1_Contig3987:406..805. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900066 VSS Citrus sinensis cDNA clone VS27Q71 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900066 ID=DC900066|Name=DC900066|organism=Citrus sinensis|type=EST|length=400bp
AAAAGGTACTGGTTACACCATGAAAGGACATATTGATGTGGACACACCTT
TTGGAGCTATGAAGTTACCAATCAGCAAGGAGGGTGGTACTACGCGCCTC
AAGAAGAACAAAGAAGATGGTGGTGATGACGACGACGATGATGAGGATTA
GAGCAGCTGCTGATGGGGGACAGTAGTGGTTCATATGAGTTGCTGTGTTG
TTTAATTATTGGAGATTTGTTCGTTATAATAATAGATCAATAGACACTCA
AGTTCAAAGTATCAACTTCTTATGTTAGCATAAATACTTCCTTTAGAGGA
GAAGTTGGTATTGTGTGTTTATGCATATGTATGCTGTTGTTACAGTGATC
GGTGTTGCATTGTGTGGCATTTGTTTTTTATCAGCACAGCCACTTACCGG
back to top