CN185860

Overview
NameCN185860
Unique NameCN185860
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length504
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2774 contig Csv1_Contig2774:661..1164. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0001P17_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001P17, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185860 ID=CN185860|Name=CN185860|organism=Citrus sinensis|type=EST|length=504bp
TTGACTGGGCGAGTCTTGCGGGTCTTCATTCGGTCCCCGAATTCGTCTCC
GCTGCACAGACACAGACGACGACTCAGAGTCATGGGGTGGCCTGTTATGC
GAACAATGACTTTTATGTCCCCTCGATGCCCCAAATGTGCCACGTAAATT
CCGGAAGGGTGGGCAACTCGGTGGAAGAGGAGGTTCAGAGTGGGCTTAGG
AATCAACGGGTTGATAACTCGGGGCTCTTTCAGCATAATTCGGCCGTATT
GACCCAACCGAACTTCTGTAGCCTGGTTGACCCGTATGGATTAAGGCACC
CGACCCAATCAAGCGGGTTTGGGTTTAGACATTGAAATATGGGTAAAATG
CCCGCGCATTTGAAATGATGCATGATATTATGAAGAAAGGATAAGTGATT
GACGAATTGTAAACTCTAGAGGTCTCGCGTTCGAATCTCCTCGAGCATCG
AAATGTTGACAAAAGTGTGATCTTGAGTCGGGAGGGATTTTTAACAAAAA
ATGG
back to top