DC900063

Overview
NameDC900063
Unique NameDC900063
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length402
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900063 VSS Citrus sinensis cDNA clone VS27Q68 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900063 ID=DC900063|Name=DC900063|organism=Citrus sinensis|type=EST|length=402bp
GCGTCCAACCATTGATCTTGAAAATTCCTCCAATAAAATTAGATATTTAA
AGTCTNAACAAATTTAAAAAGATAGGCACTACCAAGCCATAAAAGCAAAT
AACTAGTCTTAGGTTTTTGCTAAAACATTTCCAAGTAAAATTTNTCCACT
CAGATATTGATTACTTGCCCTNAAACTCATNTAAGCAAACCAGGCTATGA
AAAGTTTGGACATCAGTTATAANAATCAGCCACTTCCANAACGCACCTTA
TCTGGNGATACTGACCGNGACCTTGATCTTGCCCTGGACGACTTGACAGG
AGAAGCAGACATAGATCTTGACACTGATCTGGAAACAGAACGCTCTAATG
ATTNACTTCTATTTCTTCGCACAATTCTGCTTCTGCTTCGGCTTCTACTT
CG
back to top