CN185856

Overview
NameCN185856
Unique NameCN185856
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length669
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8088 contig Csv1_Contig8088:136..804. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0001P15_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001P15, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185856 ID=CN185856|Name=CN185856|organism=Citrus sinensis|type=EST|length=669bp
GGGGGGCCAGCGGACCCTCTTTTTTGATCATGCCTTCCATTTCATTGTAA
AAATCCATAGAGTAACATCTTTGTCCAGAACAGTTCTGCTGAAGGAAAAC
ATTTCTTCACAAAAATGGCATACAAATTTATACCGACTGTTTTGGATCAG
ACAAAGAGAATACAATGCAGTGATTACCTCTTTTCCTGGCATGTGCAGAA
ATGCGGCTGTTATCCGACAGACCCCATCTGATATGCCTTCTGAGCCATCA
ATGTCATAACTGGAAACGAGTTCAACATTATCCGGACCACTCCAATCCAG
TTGAATTTACCAAATATTTTACACGCATCCCAAACTGTATCCTTCATAAC
ATGGAAGTAATGTCTGTATTACGCAATGGGGCAATGGAGGACTAGTTCTC
GTTCATCCAGATAAAAAACATATGCAGGGGGTTTCTCGACAAAATGTCTA
TAACCTTCATCAATCACCAATAACTTCAAATTAGTTTCCTGAAGTATCAT
TATCGGGAGACGAGTCTCTTGATGCCATCTCTTCCTCCTCATCTTCATCT
TCATCATAATCCACAGAAGAAGGTTGCCCATTAAGGTCCACATTTACACC
ATTTACCTTCCTTACAAACTGTCCCCGCACACGAGGCCTCCTTTCAGCAA
GTCGCTTTCGATTAACCCT
back to top