DC900056

Overview
NameDC900056
Unique NameDC900056
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length349
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12201 contig Csv1_Contig12201:89..437. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900056 VSS Citrus sinensis cDNA clone VS27Q64 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900056 ID=DC900056|Name=DC900056|organism=Citrus sinensis|type=EST|length=349bp
AAGTGGGTTCTTGGTTATCGCAGTGAAAATGTCGGCAGTTGTGGAGATAT
GCATGGGTGAGCTTGCGAAGCTGGGAGAGAAGGTTAAAGGCAGGAAGCCG
TTTGTGTTGAGAGCTAAGAAAGAACAAGTACATGGGAAAGAAGTTAAAAA
GGAGAGCACCAAAAAGGTTGAAGATGAAAGTACAATATCAGAGACTACTA
TCTGTTTGCTTATGGACCGGTTTGTGCCTTGGTGATGTACATTCAATCTT
TCTGTGGAGCCTTATGTAGTTAAAATGGTCTTTTTTTTCATGTTTGTTTG
TAGACAAGATATGTAATCCGCAAGTAATGAATTCCATGTCCGTTTGATT
back to top