DC900051

Overview
NameDC900051
Unique NameDC900051
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length416
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10529 contig Csv1_Contig10529:935..1350. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900051 VSS Citrus sinensis cDNA clone VS27Q58 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900051 ID=DC900051|Name=DC900051|organism=Citrus sinensis|type=EST|length=416bp
CTCGAGTTTTTTTTTTTTTTTTTTTGAAGATTAATTATACCATATATAGT
AAATCATATCAGCTGCGGGCTACATGTTTTTTTAGTTTGTTCCTGCAGCC
ACTTCAGCCACTACACTTTCACCCACGAGACTGGTTTTTAACTATTACCA
CCAGCCCCGGTAAACAAGTCAAACAAAACAAAAACAGTAAAAACTGAAAA
TAAACAGAAGTTACCCCACCCACACACACTACATACTTTTAGTCACTTTT
TTCTACTACCTATCACACCATCATTTTGATCTTTTTGATTTTGACCCACT
TTTACTTTAAAAACCCCTAACACGACCCCCCATAACCCCCTGTTCCTTCG
CTTCAATTTTTTTTCCGGGAAAATAATGGAGAAAAAATCTTGGAAGGCGG
GAAACATGAAAATGTT
back to top