DC900046

Overview
NameDC900046
Unique NameDC900046
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length258
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900046_ssr89 microsatellite DC900046_ssr89:89..100.
Csv1_Contig2668 contig Csv1_Contig2668:529..786. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900046 VSS Citrus sinensis cDNA clone VS27Q53 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900046 ID=DC900046|Name=DC900046|organism=Citrus sinensis|type=EST|length=258bp
ACAAGATCAGCCCCAACACTGACTGCTCTAGGGTCAGGTGAAGTTGAGTT
TGAGCTCTGTGACTTTCCAAGTATGATTGACTGAGAAGAATAAATAAATA
AAGAATATATATGTTAATTTCTTTGTCCGAACGAGTCTCCACTTGTGTGA
GTCTCACTCTCATGTCATGTTTGTATCTTTGCTTTTAATATCATATTAAA
TATGTAAACGTGATCTGTGTTTTGAGTGATTAATTCTAGTTATTTTGTGG
TATTATCT
back to top