DC900041

Overview
NameDC900041
Unique NameDC900041
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length565
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8354 contig Csv1_Contig8354:743..1307. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900041 VSS Citrus sinensis cDNA clone VS27Q48 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900041 ID=DC900041|Name=DC900041|organism=Citrus sinensis|type=EST|length=565bp
GCATCTCAGTTATATTTATACAGTAACCACTCACAAAACTTGAAAACACT
CGAGACATTATTAAGAAGAGCACATTATGACAAACTAGCATTCAAGGACA
ATGGGCAGATGCTACTGGAGTCGGCATCATATTAATATGAAACTGNTCTT
ACCTTTTNGNCCAAATAGATTACACTTGCCAAGATATGGAGACAGGAAAA
CGAGACGGAAAAAAAATTAAAAAAAGAAAATCACTAAATGCCTAATGAAA
GAAGTACAAGAAGTTCACGACGTCTNTCAACAAATTCGACAATCAGAGAA
AGCCAAAAAAGCAGCTATTTCCAAATATTCTGTACAAACTACGGAGACAT
AATGCCCCAGCACTGNGCTGTGCCGAAGCCAAATAATGTTAGTCGTGCCT
TCCAGTTGCAGCCATACCCCATCCCATTGTATCGTCAAGGTCATTGTTAA
AAAACCCATTTTCTGNGAACTCATTGGCTATATCCTGATCTATATCATCC
TGCAAANGGAGATTCTGCTGCAAATCTTGGGCTCTCTGATTAAATCCATT
ATTGGCAGCTGGAGC
back to top