DC900029

Overview
NameDC900029
Unique NameDC900029
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length257
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8987 contig Csv1_Contig8987:95..351. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900029 VSS Citrus sinensis cDNA clone VS27Q37 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900029 ID=DC900029|Name=DC900029|organism=Citrus sinensis|type=EST|length=257bp
GATTCAGCCCTACAATCCGTTGAAGTGAAGCCATTTCTTTATCTCAGAAA
AGTCATTGAGAGTTGATTGCCATACGACTCATGAGTTACACAAAAATTAT
TGCCCTTTCGCATTGCGATGAAAAGAAGAGTTTTTCCCTTGATTAGAACT
GACTTGTGCTGTGCAGTAATTAGTGATTTATTATGAAAATTTGTGAGTGC
GGTCCAATTTTGTTTTCCGTTTATTTTTCTTAAATAATTTATATTTGAGT
TGTAATT
back to top