DC900007

Overview
NameDC900007
Unique NameDC900007
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length327
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4378 contig Csv1_Contig4378:525..851. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900007 VSS Citrus sinensis cDNA clone VS27Q19 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900007 ID=DC900007|Name=DC900007|organism=Citrus sinensis|type=EST|length=327bp
CAGAGGTGAATGATGAGGATGATGATGAAGAAGGCAGTGGCGAGGAGGAT
GATGATGAATAGAAGTTGAAGGAAGAAATTAGCATAGTCATGTTAGGCTG
TGACAATGTTTCAAACAACATATGTTAATGCTTTGTGCTTCCATGTTAAT
TTTTTTGGATGCTTTCATCATCTTCATCATCATGTAAGAGAATCATGTTG
CTTCTCCCTCGACATTTTCTTATGCCTGCCTTTCGAAGAATTAATAGCTG
TAGGTGGGAGATTCACTGCTCTATATGTACTGTGTTCTAAAGCTTAATGA
TTTAGCTAAGGCGTTCCATCGTTTGTA
back to top