DC900006

Overview
NameDC900006
Unique NameDC900006
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length450
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900006_ssr213 microsatellite DC900006_ssr213:213..224.
Properties
Property NameValue
Genbank descriptionDC900006 VSS Citrus sinensis cDNA clone VS27Q18 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900006 ID=DC900006|Name=DC900006|organism=Citrus sinensis|type=EST|length=450bp
TTGGGTCCCTCAAGCTCCATCCCCCGTTCAAACTTGTCTATATTCTTCAC
AATCACAAACAGCGGGACATATTAGTTTCAAGGACGCGAAGGAGGTAACC
GGCGTGAAAGCCGTGTCTAGCAACAGGAGATATACAGAAGATGTCTTTAC
AGTTCCGCAAATCAGCCCTCAACTAGCTGGCTTCAAGAGATCTAGGCCTA
ATATCTGGGAGGATTAATTAATTAAATGCATGCTCTTATCATGAACAAAT
TAAGCCTTGTGGTTTCTCTTTCACTTTCTTTCCTTTGATTGTCCTTTCAG
TTTCTTGATCTGGTATGGTTTAGTTTGTAGTGGTTGCGCTCTTAGTGGTC
CAAATCCAACTGGGTTTTGTCTCCTTTGTTTTGTTTCATCTCCTTTCCTT
TGTACTTGCGACAAGCACAGACATGAACGTCTTTGTAAATACTATTTGCC
back to top