DC900002

Overview
NameDC900002
Unique NameDC900002
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length264
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10323 contig Csv1_Contig10323:356..619. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of DC900002 vs. ExPASy Swiss-Prot
Match: PRF1_SOLLC (36.4 kDa proline-rich protein OS=Solanum lycopersicum GN=TPRP-F1 PE=2 SV=1)

HSP 1 Score: 72.4034 bits (176), Expect = 8.075e-13
Identity = 31/46 (67.39%), Postives = 37/46 (80.43%), Query Frame = 1
Query:   49 TCPIDTLKLGACVDLLGGLVHIGXGDPVVNQCCPVLQGLVELEAAV 186
            TCPID LKLGACVD+LGGL+HIG G      CCP+L GLV+L+AA+
Sbjct:  260 TCPIDALKLGACVDVLGGLIHIGIGGSAKQTCCPLLGGLVDLDAAI 305          
The following BLAST results are available for this feature:
BLAST of DC900002 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
PRF1_SOLLC8.075e-1367.3936.4 kDa proline-rich protein OS=Solanum lycopersi... [more]
back to top
Properties
Property NameValue
Genbank descriptionDC900002 VSS Citrus sinensis cDNA clone VS27Q12 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900002 ID=DC900002|Name=DC900002|organism=Citrus sinensis|type=EST|length=264bp
AAGCCATGGCCCATGTTCATACACCACCACCTCCACCAGCGGGCTGCCAC
ATGCCCCATTGACACCCTCAAATTGGGTGCTTGTGTGGACCTTCTTGGTG
GGTTGGTTCACATTGGTCNTGGTGACCCAGTTGTTAACCAATGCTGCCCA
GTTCTACAAGGACTTGTTGAGTTAGAAGCTGCTGTCTGCTTGTGCACTAC
TCTCAAGCTCAAGCTGCTTAATCTTAACATCTATCTTCCACTTGCTCTTC
AGCTTCTTGTCACT
back to top