DC899999

Overview
NameDC899999
Unique NameDC899999
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length469
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11045 contig Csv1_Contig11045:648..1116. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC899999 VSS Citrus sinensis cDNA clone VS27Q10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC899999 ID=DC899999|Name=DC899999|organism=Citrus sinensis|type=EST|length=469bp
CCCAGCTGAGAAGACTGAGTAATAATATTGTAAGAACTAATGATGGCCAA
TTTGCACGTCCAAGTTAATTTAGTTCAGTGGTTTCAAATATTTTAGTATT
CGGTAACAATAAGGGATTTTGTTTGAGTCTTGGTATCTGCAAACGACCCC
ACTTTTGGATCTACCATTAATTGCAACTCCACATAGCTGATCATCATGAC
ATCCATGATCAGTGAATTGATTCAAAGAAAAAGCATGGTCTGAGCTTAAT
GGTGAAATTTCGGTACGTGCTATGAGGAATTGGGTTGTTGGTGCCAAGTG
GTGGGTTCTTGAAATTTGTGTATTATGTACTGTTTGCTTGTATGTTATAA
ATAGAAGCTCAAGTATGTTGTTGGCTACTTGGCTTGGTGAATCAGTAATA
ATAATATATATCAGTTGTTTTGCTTAATAATAAAATTATATATATGTAGT
GTGTCATAACATATATTTT
back to top