DC899997

Overview
NameDC899997
Unique NameDC899997
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length875
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DC899997_ssr491 microsatellite DC899997_ssr491:491..502. BLAST: Citrus ESTs to Prunus persica proteins V1
DC899997_ssr813 microsatellite DC899997_ssr813:813..828. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig475 contig Csv1_Contig475:18..892. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC899997 VSS Citrus sinensis cDNA clone VS27Q08 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC899997 ID=DC899997|Name=DC899997|organism=Citrus sinensis|type=EST|length=875bp
CTGAAACGGGCAATGTTGGTCTGCCGGGTCGTGGCGGGCCGGGTCGGGTG
CGATGCAGATGACGACGTGGATATGGCGAAGGAGAATGGCGGGTTTGACT
CGGTCGTCGGGAGGGGTGCCGGTGGGGTCAACTCAAGAGTGGACGACGAT
GAGGAGCTTTTGGTCTTTAATCCCAGGGCTGTGCTTCCTTGCTTTGTGAT
TGTGTACACTGTGTAATGACGGTGGTGTTGGGAGTGTGTGTTCTGTTAAA
TCTCCTGAGAAACTTCAATCTGCAATCTGTATGTACGTAACCCTTATTTT
GTGACAAAGTTTTTTACTGTAAATGTGCGGTGGCGATGGAGTTCTGGTTG
CCGGTTCTTGATGTGGGTCCCAATATACGTGCCCGTGTGACTGCTTGCTG
TAGTTTAATTTGTCCTACTTAGTCAAATGCATGATAATCTATCGAATGGT
GTTGCGGCTATCATGGTCGCAGCGGCCCGTAAAATTTCTCTCTTTCTTTC
TTTCGTTTTCTCCCCAAAACAACTACTAATCGTGATCAGCACAATGATGG
TGGTTGGTTGAGTACAACTGATCGGCATAATGACAATTTAGTAGTACAAT
GTTCTGAAAATCAGAAGAAGGCAGCTGGGAGCTCGTCCGATCAACAACGA
AGAGATCTCGGAGGAGTAATGTCACTTGTAAGGTTCAGATAAATTGAAGT
GCTGTGCCGCTAATCATTTAAATCATGGTTCGTTGTTCATGGTTTGAGTC
TTTTGAGTATCAGTGTTTAAGTGCTCACTTAGCGAACGCCATAAGAACTT
ATTTTGATTTTGGTTTGTTTGTTTGTTTTTTCATGTAATTAAGTGGGATA
ATGCTAAAATTATGCTATCTTGAGT
back to top