DC899991

Overview
NameDC899991
Unique NameDC899991
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length645
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8768 contig Csv1_Contig8768:168..814. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC899991 VSS Citrus sinensis cDNA clone VS27Q02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC899991 ID=DC899991|Name=DC899991|organism=Citrus sinensis|type=EST|length=645bp
AGACAGAAGAATGAGAAAGGAATAGGTGGCACAGCAGATGCTGCTTGTCA
ATCACTCTTACGGAATGCAGATAAGTATTGTAAGCTTGTATCTGGCAAGC
TGTCAAGTGGTCATGGTTGCCTGAAAAGTGTGGCCCTTGCTGTTATTGCA
ATCGCCGTCGGTGCTGCCTTCATGTCCCCGAACGTGGAGTCCCTGGATTG
GGAGAAAATTTCTGTGTTTTTTACCTCCCAGCCATCTATTTGAAAGTGAT
GGTTTATATTTATTGGCAGGAATTGATGCAAAGCATCATTTTATTCTTAT
CAATACTTATCTTCTCTCCAACTTTCTGCTGCTGACCAAGAAAGGCGAAG
GGCTTATCTTTTATTTTACACAGTTTTTTTGGGGACATGATTTGATGACT
TTGACACGATATCAGAATACAGGCCTTTTTAAGTTTCTGAAGAATCCAGC
CACCCCCCTAGGACACAATAAGAGGAAAGATTGTGATTGGTTCTAGTTTA
CATGATGGTGTACTACAAAGAATAGCGTTATTTGATGATTTTTTTTTTTT
TTTCACTTGTAGATCCTGATCAAATTGAATGATTAGGTTAATGGCGGGAA
ACATTTAGAATCTTTTAAGAAATGAGTTTTCTGATACAATTACAC
back to top