DC899990

Overview
NameDC899990
Unique NameDC899990
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length302
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC899990 VSS Citrus sinensis cDNA clone VS27Q01 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC899990 ID=DC899990|Name=DC899990|organism=Citrus sinensis|type=EST|length=302bp
ACAGGATGGGGTAAAACAACTAGAAGGCCTCGTCGCCAAAGATGCCCTGC
AGGTAATCCTCCAGCTCTATTAACATAATAACGGGAAGTAGGATCCAAAT
TTTATCATTTGAACATTCTATAGAGGGAAGTAGGGAGTTGTTTCCATGGC
TTTGAGGAGTGATGCTTATTGTAAGACACGGGGATTGTCCTTGTACATTC
CATAGCCCATAAATTCGGGTTCTCTTAATTATCTGTCTGTNCTTTGGGTG
GTTACAGACTTTGTATTATTCATAAATAATGTTGAATGATTTCTTTTCGG
GA
back to top