CN185676

Overview
NameCN185676
Unique NameCN185676
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length118
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0001L09_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001L09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185676 ID=CN185676|Name=CN185676|organism=Citrus sinensis|type=EST|length=118bp
TTATTCGAAGCATAACTTGTTCAACAAACAACTTATAAAACCCTTTGAGG
GTATTATTAATGATAACTAGTCTTCTTCAAGCCCTTAGAGGCCATAGCGA
CCAGCTTGAACAGAAAAT
back to top