CN185574

Overview
NameCN185574
Unique NameCN185574
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length730
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13785 contig Csv1_Contig13785:46..775. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0001I22_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001I22, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185574 ID=CN185574|Name=CN185574|organism=Citrus sinensis|type=EST|length=730bp
TTTTTTTTTTTTTTTTTATCAAATTGTATGTTCCGCCCCATTTCAAATGA
TGTCCCAAGATTACATAGAAAAGAGGAAAAAAAGAGAAAGAGGAGGGGGG
AAGGGAAACCAATGGTGCAATAAAAAATAGATTGTTACTACACACAATCA
ATAAAATTTGCAATCCGCTCCACATGGGAGCATCAAATAAAGGACGGGGA
ATACAAACACAACTCATTCCAACTACCTTCTCCTAAGATACCCGCAGTAA
AATTGGATCTCTTTATCAAACAAACCAAAGGGGCCTTCTCTTCTTCCTTT
CTCTGCAATTTAATTCTTTCTGGCCAACTTCCCATCTCAGGTCTGATCAG
TTCTAGAGTCAGAGTCGCCATCATGTGCCTTCAAACCTAAACGCAAATCC
AAAGTGCTCTCATTTAAATCCTGCCCTACTATCTGTTCATCATCCTGATT
TTCTTCCATAGGTACATCATTAATGTCAGGCTTTCCATCAAAACCATCAT
TCCTGGGAACTGGCTCACCTGCACTTGGATCAATATTAGTAGGTTTAGCA
TCATTTTCAGCATTTTCTGCTGCCTCATTTTCCGCAGCTCTTTTTTGTTC
CTCTAGCACGGCAATCGGAATGTATTTGAATTTCCGCCGAGGGGGCTCAT
CCGGCGCCGTATCATCCTTAACAAAATCCTTCCCGCCACCGTTAATGCTG
TTACCGTTGTTGTTACCCGCCCTTATCTCG
back to top