CN185572

Overview
NameCN185572
Unique NameCN185572
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length733
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
CN185572_ssr211 microsatellite CN185572_ssr211:211..226.
CN185572_ssr17 microsatellite CN185572_ssr17:17..31.
CN185572_ssr319 microsatellite CN185572_ssr319:319..330.
CN185572_ssr492 microsatellite CN185572_ssr492:492..509.
Csv1_Contig13688 contig Csv1_Contig13688:78..810. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionUCRCS05_0001I21_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001I21, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185572 ID=CN185572|Name=CN185572|organism=Citrus sinensis|type=EST|length=733bp
TTTTTTTTTTTTTTTTTAATAATAATAATAACTAATCTCCCTTTTAATAT
AATTGATAATGGAAATTCACATTGACAAAACGCTAATTACACACTGACTG
GGCAAAATAAATAAAAAAAAAACAGAGTCTCTCAAAAGCAATAATAATTT
AAACACAACACCCCCTTGAGTAGACACCCCAAAAATAAAGCAGCAAGGTC
TTACTGTGACCACACACACACACACACCAAATTTTTATTATAGAATAAAT
CTAAGATGATGGATGATGATGCTGATGTTGATGCGTCACATAAAAGTTAA
TTAATTTAATCGCTGTCACTGCTGCTGCTGCTCTCGTGTCCGTCCTCGTG
CTTCTTCTTCTCCTTCTTCTTTTTCTTCTTCTCTTCACCGTGGGCGGCGC
CCTCGCCGCCGCCGACACCGGGGATCTTCTGCTTGATCTTGTCCACCAAG
CCCTCCTTGTGTTCGCCCTCCCTGTGTTCCCCGCCGTGATACTGCTGCTG
CTGCTGCTGATGGTGAACATCAGTAGTACCGACACCGGGGATCTGCTGCT
TGATCTTGTCCACCAAGCCCTCCTTGTGTTCGCCGCCGTGATACTGCTGC
TGATGGTGAACATCAGTAGTGTGGGGGTCCCCACTATGGTGCTCACCCTT
GTGCTTGTCCTCCTCCTTTTGCCCTCCTCCCATGTGAAGGGCTTCTCCGA
TCTTGTGAATAACTCCTGACATTTTCCCTTAAA
back to top