CN185509

Overview
NameCN185509
Unique NameCN185509
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length350
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0001H09_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001H09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185509 ID=CN185509|Name=CN185509|organism=Citrus sinensis|type=EST|length=350bp
AGTAAAAGTGTCCCCTTTCTGCTCCACTCCTCAAATGAATAAGAAAAAAC
TAAACCGGAGGAATCTACACTCCCAACTCCCATTGCAGCAGGGAAACACT
ACATAAGACTTATTCAACTCCTACTCTTACGAAACAAAGATAATTAAAAA
AGTTTAAAAAAAGGTTTCGGGTGGGCGCGCTTATCAAAAACAAAAGTAAT
TCTGAAATTATACCAAACGTATTCTATATATCCACAAACCGTAAATACTT
CATCAGCAAACTGCCCTTGAAATAAAGCTCAAGAATTTTACTTCAGCTCC
GCACATTTGATGATGTCAATGAACTCCGGCTTCATACGAAGCACCACCAA
back to top