CN185505

Overview
NameCN185505
Unique NameCN185505
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length568
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS05_0001H06_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001H06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185505 ID=CN185505|Name=CN185505|organism=Citrus sinensis|type=EST|length=568bp
TTTTTTTTTTTTTTTTTCCCCTTTGCAGCCAAAACAAAACAACTGCCGTC
GGGTTGCATTAAAAATCTACACATAACGTACGTTCCTACGTATTTATATA
TCAACAGTCCGTTCCTAAAAACAAGTTCCTGGGCCCTAAAACCCTTTCAA
ACGTTTTTTTTTTTTTTACCCCGTTTCTGCGAAGCTGAAAGCGACTCGGG
CCGCCATGCAAAATCTGAAATGGCGGCCGGTTCGTAACTTTCAAACAAAC
CCCCCCCTAACGTTATATAGTCATTAAAAAAATTAACGTCCCCCCCGTCC
GCGTCCCCCCAAATGCCAAAATTGTACCCCCCGAAACTAGGCATCTCGTT
TTCAAACCCTAACGCCATGTCATCCAGCTTAACGGGGGCGCAACCGCTCG
TCTTCAAATCAAGGGGTTCGATTTTTTGCTGCCCCCCTCCCGTCAAAAAA
CTCGGGGGGGGGCCGAGCTCATCGTCAGAAGCTTCCAAAAGGAAACCGAG
CTCCGGGCGGGGCTCGCCGGGATCCGAAGTCCCCCCCGGGGGGGCCTGTT
CTGGAACGAAAATCTCCC
back to top