CN185502

Overview
NameCN185502
Unique NameCN185502
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length324
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0001H03_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001H03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185502 ID=CN185502|Name=CN185502|organism=Citrus sinensis|type=EST|length=324bp
TTTTTTTTTTTTTTTTTCTTTTTTTATGGAGAATATAAAAGCTTACCCCT
TTTGGGCCTCTGATTAAACATTACAGAACAAGGCTTAAAGAAAAAACCCG
AAACCCACCCGAAATTATGTATCTACCAAAACATCCCCATTATTATTAAG
TACGCCCTACATAAACATCTATTTGGGTAATAGTACTACTGGGGCTTAAG
GGGGGGGGGGGGCGGTGTTGCACCCTTCTTCCCCTTGGAGCACCTAAACA
ATTATTTCTCTGCCGAACACCCAGCTGAACGGGACAGGGGAAGCTTGGTT
GGCCCTTCCTTGGGCTCCCTCGGG
back to top