CN185489

Overview
NameCN185489
Unique NameCN185489
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length598
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN185489_ssr33 microsatellite CN185489_ssr33:33..44. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0001G18_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001G18, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185489 ID=CN185489|Name=CN185489|organism=Citrus sinensis|type=EST|length=598bp
TTTTTTTTTTTTTTTTTGGAATAATGCACACATTATTTATTTATTTAATT
GAATACCATATTTGCAGTTTTCACAGTGAGTCAACCAAAATTTAATAAAA
TACAGATGGTCCAAACATTTTGAAACATGATTCACAACAAGCACGCCTAT
AAGTAAAGTGGGCACAACATCATTGTGTCGAACAGAAAATCCATCATAAT
TGGAATTGCGAAAACCTCACATGTTACTCTTTCACATTTAAGCTGCTTGA
CAAAAAACAATCCCCCTGAAATTATTAACCTCTGATTTCTACTCTTGATT
CATTTCACCTAAATAACTAACATCTGACTAATACAGCCATAGCATTAGCA
GGGTATAAGAAACATAAAACAGACATTGTATGCCTCATTTCTTCGCCTTA
GCTTTCTTTGAAACTATAGTTCTCTTTCTTGCTCTCTTTGGGGGCTGTGG
CGGTCCTCCAGCACTCGTACCTCTCTTTCCTGCAGGCCCAGATTTCACTT
TGGTCTTCTCATTTGTTTGTTCTTCAATGCCATCATTTTGATCAATTTGA
TGAGGCATAGCTTTAGCAAGCTTGTCAGAATCATCTTCCGAATCAAAT
back to top