CN185466

Overview
NameCN185466
Unique NameCN185466
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length674
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN185466_ssr28 microsatellite CN185466_ssr28:28..37. BLAST: Citrus ESTs to Prunus persica proteins V1
CN185466_ssr405 microsatellite CN185466_ssr405:405..416. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig5008 contig Csv1_Contig5008:114..787. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0001G02_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001G02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185466 ID=CN185466|Name=CN185466|organism=Citrus sinensis|type=EST|length=674bp
AGGCATCTCATTTGGTTTTCTCTCTTTTCTCTCTCTCCATTTCTCAATAT
TCTCTCTTTATTTTCTTTGGTTCTGATCTGCTATTTTTCTGAGAAAGCAA
CCAGGAATAATGAAGAAGGCTGTATTAAAGTTGGATTTGGATGATGCTAA
GGCCAAGCAGAAAGCTTTGAAGACTGTCTCTACTCTGTCAGGGATCGATT
CCATTGCCATGGACATGAAGGAGAAGAAATTGACAGTGATAGGAACCGCT
GATCCTGTAAACGTTGTGAGCAAATTGAGAAAGTATTGGCCGACGACAGA
TATAATATTAGTTGGGCCAGCAAAGGAGCCGGAGAAGCCAAAGGAGGAGC
CAAAGAAGGAAGAGCCGAAGAAGGAAGAGGAAACTAAGAAAGAAGAGCCA
AAGAAAGAAGAAGAAGCTAAGAAAGAAGAGCCCAAAAAAGAAGAACCCAA
GAAAGAAGAAGAAAAGAAAGAGGAAGAGAAAAAGAAAGAAGCGGCACCGG
CACCGGTACCACCACCGGATCCTGTTTTAGAGCTTGTTAAAGCTTACAGA
GCTTATAATCCTCACTTGACCACTCATTACCATGTTCAAAGCATTGAGGA
GAATCCAAACGCTTGTGTTATTTGTTAATTTCTCAACAGAAACTAAAGAC
ATTTTGCTAAAAAAAAAAAAAAAA
back to top