CN185462

Overview
NameCN185462
Unique NameCN185462
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length598
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0001F23_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001F23, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185462 ID=CN185462|Name=CN185462|organism=Citrus sinensis|type=EST|length=598bp
TTTCATCGATCATAGTTAATATAACTACCCCTTTTATAGCTAAATGAATA
CTTCATTGATTCTTAATTTGTATCCTAACACATTACAATTACAATTCTTA
AATGAAGAATCTTGAGCCAACCACTTGAATCAACCAGCAACACCACCAAA
ATGCCGTCATAGACCAATGATGACCAGAATTCATGCGACGGTGACTGGGA
AGGTTGGGATAGAAGCTTCATACTACACTGAATCCAATGGTGGCAGTGGT
GTGCTCCAACGCGCGACCACGGCACCGGATCGAGCTTCGACAACCGTGAA
ATTTTAATGGTTGATCGGCGGCGATTTGGTTGTTTTTTGTGCCGATTTCT
GGTCGAGTTTTGAAGAGTGTGTCGTGAGGGGCAAAACCCAGATGACGGCG
GCTCATAAATCTGACAAAATCACCGTCGATTAGAGGCAGCAATTACTGCA
ACCTTTCGGGCTTCTTATGGTGGCCTCTTGCCATTTTCGCCGACAATGAT
GGCTGGGTAATCAGCGGCGTCTGTTGGAGGTTCCATTGGTACCCTCTATT
GCTGGTGAGGTGGCCGGAATCGAGGCAGCCAGGATTGGCTCTTGGCCT
back to top