CN185393

Overview
NameCN185393
Unique NameCN185393
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length496
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN185393_ssr418 microsatellite CN185393_ssr418:418..429. BLAST: Citrus ESTs to Populus V2 proteins
CN185393_ssr266 microsatellite CN185393_ssr266:266..280. BLAST: Citrus ESTs to Populus V2 proteins
CN185393_ssr179 microsatellite CN185393_ssr179:179..198. BLAST: Citrus ESTs to Populus V2 proteins
Properties
Property NameValue
Genbank descriptionUCRCS05_0001E08_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001E08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185393 ID=CN185393|Name=CN185393|organism=Citrus sinensis|type=EST|length=496bp
ATTTGATCTTTATTAATACTCTTTTTTTTTTTTTTATCTGCTAATAAAAA
AACCAGAAAGAAACACGTACACAACTCCCAACTCCAAGAATTAAGAATAT
ACATTATAACATACAAAAGAAAAAGGAAAGATTGATTGACAAATTCAGCC
GCCAAGCAACATATTTAAATTTTACAAAAAAAGAAAAGAAAAGAAAAGAC
GGTGAATGAGACTAAGCTTAAGCGGGGGCTGGACGCAAGGGAGGTCTCCT
GCTGAAAGCGGAGGCGGAGGAGGAGGAGGAGACAAATGGAAGATTGCGAA
GAATGAGAAAACGAACACGTCTTGGAAAAGGAGCGTCGTGAAACAAATGC
TCAAGCACCCTCGCCAGCAGCACCGTGTACTCCTCCATTAGCTCTGCCAC
TATTGCTACCAGTATCATCTCTCTCTCTCTACACCTTTTATTCACTTTTT
TATTTTTATTTTTATTTCTTCCCCAAATGATGATGACGATGATTTC
back to top