CN185378

Overview
NameCN185378
Unique NameCN185378
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length631
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0001D24_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001D24, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185378 ID=CN185378|Name=CN185378|organism=Citrus sinensis|type=EST|length=631bp
TTTTTTTTTCCTTTGAAATTTCTCCCATGCAATAATCCATTTAAAATTTC
CTCCTAGCAATAATCCAATCTTAAAAAGGCAAAGATGTGAACAGACCAAC
ACGAGTTAATCCACCATACGCTATTTAAATTACACATGATTTACTCCATA
ATAATAAATTACTACACAAGTATACAACAATACATGACGATTTGCAGTAC
TCGAAATCCAAATCATAATGAGCTCTCTCTAGTTGTTATTCCAAGTTTCT
ACCATTAAACCTCTACAAAGCTACATAAAATAACATTATGTTTGAATCCC
AAATAGTCAAATCCTTGAGGCATACCAGTTGGCATTAACCTGATCTCACC
TAAGGTGAAAGGGATCGAGATATGCTCCGGGTCCTGCTTCGACTGCGTCC
CCTTGGGCTACGAGGAGATGACAATGGAGAACTGGACCTAGACCGGGATC
CAGTCTTTTTCACCAAGTTAAAAGAGAATCATTGGGCAGAAGTTTGAAGG
AAGCCGAAGATGCCTTGAATTTTTCAGTGGTAATTGCACCTAAATCATTC
CTTCCAGCTCTAAATGCAACCCTTCCTTCTATATTGTTCCATGAACACAA
TAGGTGGAAGAAGGAAAGCAAAAGTGGATGA
back to top