CN185375

Overview
NameCN185375
Unique NameCN185375
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length539
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2477 contig Csv1_Contig2477:1..539. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0001D22_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001D22, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185375 ID=CN185375|Name=CN185375|organism=Citrus sinensis|type=EST|length=539bp
TTTCACAAAAATTAAATTCTTGTATTTAGACGCCAATCCGAATATCCCCC
TTAGCAAATATAGATCATTGTACAACCACATCAAATTGTTTATTAACACC
ACAATAAATTTAAAATTAAACAAAAAAAGCTCGAAAAACACAAACCACTG
GACGGAATCTCAATCGAACATTTATTCAGTTTGTTTATTTCTTATTATTG
GCGTGTTACCTCCAGCGGAATCTCCGCCAGCCGCCTGCGCCGCCTTCTTG
GGAGCCTTCTCCTGCAGCGGCTTCACGTCCCTTTCGCGGCGTTGGGCGGG
AGTCAAGCCGTCGTCCTTGGTCTTTCCCTTGCTGCCGCGAGCGGGCGCTC
GCTCGCGATCGCGTTCTCTCTGGTTTCCGCGAGTCATGGTTTCGGCTACT
CGATAGAAAAGACAATGGGAAATTGCTTCGCAGTTCGTTCAGTCAACCTT
TGTACGCTTCATTAGCTGCCACAAAAACCCTACCCTCCGTCCCCGCCACC
ACGAAAATGACAGGAGAAGCAGTGAACCCTAAAGCTTAC
back to top