CN185245

Overview
NameCN185245
Unique NameCN185245
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length751
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1981 contig Csv1_Contig1981:1216..1966. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0001A16_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001A16, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185245 ID=CN185245|Name=CN185245|organism=Citrus sinensis|type=EST|length=751bp
ATGTTTTTTTATAACTAATATTAATATCTCAATTTATTCCTAATCCCAAA
AGAATAATATAACAAAATTATACAATCCCAACAGAACGAGATAATCAAGA
TGTCCTAACAAAAACATTTATATCTTCTAACACCATCATGTGCCCAAGAC
TCAAAATATATTTACAGTCGCTGGGTCGGTCTGGTGTACCTGCAACCTCC
TGGTGAGGGGGGGGGGGAAATATAATAAAAACGAGGTGAGTTTAAAACTC
AGTGAGATCAGTGAGTGGATAGTAGTTTTGAAAATTAATTCTTACTTTAA
AAGAAATAATCATTTCATTTCCAAATACGATTGCATTAAACCATAAGCGA
AAAACCATTAATAAATCATTTAACATTTAAACCAGATTACTAACGATGAA
AAGCATATATAACGATCATACGTAATAATCATGGAAATCATATCATAATA
TCATTTAGAATCCACAAATCTGAAAATCATCACCAAACAAGTACCTAGGG
AAATAATCTCGTCATATCCGGACCTCAACGGACGGGCAATGACGTACTAT
CTGGGTAACGTCACGCCCCGGAGCTACACGGATAGACAGGGAAATATCAT
CTCATATCTCATCATATCTGTGCATGCATAATCTGGTCCCCAAGGGACAA
AAGCGCCCAAGCACACGACCCAAAGCCTCTGTGTGTACTTAGACAGGCCC
CAAAGGCCTGTATCTCATCTGTATCATCTGTAGCTCAATATCTGTCTGTA
T
back to top