CN185243

Overview
NameCN185243
Unique NameCN185243
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length693
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2506 contig Csv1_Contig2506:82..774. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0001A15_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001A15, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185243 ID=CN185243|Name=CN185243|organism=Citrus sinensis|type=EST|length=693bp
CTTAAATATTATTTTAAACAAGAGCAATAGCTTAATCAACCTATGTCATG
TTTATAAATCAACTACCCAAAAAAAATAAAAATCTGTAGATGAAAATAAC
ATTTCTTGCACTACAAGCAGCGTAAACTTTCTTCATTTGATATTTTGCAG
GAAAATCATTTGCGTGCTTCCGCTTTCTTCTGCTCTTTGGCAGCCTTTTC
TTCTTCTCGCTTTTTAGCAGCTTCGGCCCTTTGTTGACGTATAAGGGCTA
AACGTTCTAAATCTAGCCTTGCCTTTTCGGTTTTCCCTTGTTCTTGCAGC
TGCATGTAACGCTCATGAGCTCGCTGCTTCTCTAGTTCCTCTCTTTCACG
CCTTGAAAGTTCAGTTGTTTTCCCAAAATCAACATCCTTAGCTTTCAAAT
TCTTCGCCTTGACCAAATTAGGATTATTAATCTCAATCAAACCTTGAGTT
CCTTTCCGCCTTTCCGATTTCTCCTCCAATTCTTCTCCCGACTCCTCTCC
AGATTCTTCTCCAGCTGCTTCATCTTCAGACACTTCCTCTACGTGTTCAG
CTTGTTCCCGTTTAAAAGTGCGAGGACGTCTAGAAGTTCCAGCAAGAATA
TCTTCAGGAGTGGAGAATTGACGTTGACCGGTGGGCTTACCCTTGAATTT
GCCTCTCCCCATCGTAATATTAACACCAACAAATTAAAAAAAA
back to top