CN185242

Overview
NameCN185242
Unique NameCN185242
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length174
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10012 contig Csv1_Contig10012:432..604. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0001A15_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001A15, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185242 ID=CN185242|Name=CN185242|organism=Citrus sinensis|type=EST|length=174bp
TGAACCTCCACGGGAATATTCAACTGCACTTTTATTATAATTAGGGGTAG
AATAGTAAACCAGGCACACGAGACGAGTCGTGGGGCTTTAAGGATGGGTA
GGCTTCTCCAAGTCTTCCAGACTTGTGGGGGGGAACCAGGCTTTCTCCTC
CAAGACAGATTCGTCGCGACCATT
back to top