CN185236

Overview
NameCN185236
Unique NameCN185236
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length530
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN185236_ssr89 microsatellite CN185236_ssr89:89..100. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig2469 contig Csv1_Contig2469:1..532. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0001A11_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185236 ID=CN185236|Name=CN185236|organism=Citrus sinensis|type=EST|length=530bp
GCCAGGAACCAGACGACTCTGAACTCTATAAAAATTAATCACCAAAGGCA
TCTGAAAATGACCCAATAATTTGAAAAAAAAAAAAAAGAGAAAGAAAGAA
AGGAAGGAAAAGACACTGATTCATTTTAAACTCAGCTTTCGATCTCAGGG
CCGCGGGGATTAAAAACCTGTCGTTTTGTTCAGAAGATCGCGCGTTACGT
TAGTCGTTTTTAGCTGGTACCGATGATAGAATGCAGCGTTTGTCATTCGA
CGCTCGAATTGGAGACTGTTGGCGGCAAAACAGTGTCGAGAGCATACGAC
AGGCACCGGCACCAGGTCTCGTCCAAAACGCGCTTCCTTAACGTCGCTTT
GGTCGTTGGTGACTGCATTTTGGTCGGACTACAGCCAATATTGGTGTATA
CGACTAAAGTTGATGGAGGCTTCAAGTTTAGTCCAGTTAGTGTTAATTTT
TTGACAGAGGCAGTTAAGGTTTTTTTAGCTATTGTTATGCTTTTGCTTCA
GGCGAGACATAAGAAAGTTGGTGAGAAATC
back to top