CN185234

Overview
NameCN185234
Unique NameCN185234
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length179
Alignments
Feature NameTypeLocationAnalysis
CN185234_ssr90 microsatellite CN185234_ssr90:90..101.
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0001A10_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001A10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185234 ID=CN185234|Name=CN185234|organism=Citrus sinensis|type=EST|length=179bp
CTTGAGGAATTAACCCATGTATTTTTATACCGGCTAATCCCTAGGCCTGG
TGAGAGACGGAGGGAGATCAAATCATTGATATATTGTTCTTATTTATTTA
TGTATTCATTGTTCTTTCTTTTTTCACATTAATTAAATTAATATAATTGT
GTGTTCATTTTCTAAAAAAAAAAAAAAAA
back to top