CN185233

Overview
NameCN185233
Unique NameCN185233
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length178
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13053 contig Csv1_Contig13053:310..487. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0001A10_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001A10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185233 ID=CN185233|Name=CN185233|organism=Citrus sinensis|type=EST|length=178bp
TTTTTTTTTTTTTTTAGAAAATGAACACACAATTATATTAATTCCCCCTT
TGTGAAAAAAGAAAGAACAATGAATACATAAATAAATCATAACAATATAT
CAATGATTTGATCTCCCTCCGTCTCTCACCAGGCCTAGCGATTAGCCGGT
ATAAAAATACATGGGTTAATTCCTCCCT
back to top