CN189137

Overview
NameCN189137
Unique NameCN189137
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length573
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Washington Navel Orange Stored Fruit Rind cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS06_0001G02_f Washington Navel Orange Stored Fruit Rind cDNA Library Citrus sinensis cDNA clone CS_WEc0001G02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN189137 ID=CN189137|Name=CN189137|organism=Citrus sinensis|type=EST|length=573bp
TTTTTTTTTTTTTTTTAACGGTTCCATAAAAGAAACTTCATTTGACGTCT
ATTCAATTTTTCCATATAATACTATCTTAAGACCACACTCGAGATTGGAC
TGGGAACATTTACATAATAGAGGATACAAGCTTCTTGACTGTAGTAAAAC
ACTGAGAATAAATGCAGTATTAACTTCAAATATTATCTGAAAAGGTAGGG
GAGACAGCAAAAATATACTTTAGGTGATTTTCATGCCAATGGCATATAGT
GCCAGCAGGTGATTAGGTCAAAGAATGGCACACCCTCCTTTTTCAGCTTG
CTTACGAAGCTCCTCTGTCTCCCTCTGAGCTCTTTCAAGATTCTCTCTAA
GCTTACGAATTTCGTCATTCGACTTCATTTGAGCTAATTGTGCGACCTCT
TCTGCCTTTAATCGAGCAGCTTGCTCCTCTGCCAATTGCTGTTCGAGCCT
AGTTGTTGTCTCTTTGAGCTTAGACTCAACCATCTCAGTAATTCGTTTGA
GTTGATCTTCATATGATTTATGCATCTGCTCCTTCAGCTCTGAAATTTCT
CGTTTTGAATATCCCTTGAGCCT
back to top