CN189119

Overview
NameCN189119
Unique NameCN189119
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length798
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2707 contig Csv1_Contig2707:1..799. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Washington Navel Orange Stored Fruit Rind cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS06_0001F14_f Washington Navel Orange Stored Fruit Rind cDNA Library Citrus sinensis cDNA clone CS_WEc0001F14, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN189119 ID=CN189119|Name=CN189119|organism=Citrus sinensis|type=EST|length=798bp
GCAATCTAAACCACCGAAGCCTGACTGTGTTGTTGTCCAAAGAAAAGCAT
TCCCCTTCGTCTGCTTTTGTAGAAACTGTTGAAGAGATCACGAGACTTTA
CAGATCACTGCCACCAAGACCCTCCATTGAACAAGTGGAAGCAGCCATGT
CTGTTCTCCAAACTGTTGATACCGAAGAACAGACCAAGCTTGATGAAATA
ACAAAGCAAGAGAAGCCACGTGATGTTTCTGAAGATTTGTTTTCTGTGCT
GCAGCAGTTTAAAAAGACTATGGTTTTGTTTCAAAGCTGTGAACAGAGGA
AAGAAGCCAGTCACTTGGTTGAAGTTGATAAGCTTTATGGGATCTTTGAT
GAACTTGTCCGACGAGCTTCTGGCTTGGTTTCTGGGGATAACCAGATGGA
GAAAGTGGCTGCTTTTGCTGACTCAGGTGGTAAAATTGAAAAGGAATGTG
TGATCACTGATGAGACTTTGGTGAAGACAAGAGAAGATGGTGAAATTAAG
AAAGATGGTTTAAAGGATTTGGTCAAAAGTGCTTCTAAAAAGGGTTCTTT
CTTTATAGGTGAAGAAAACACTGAAAAATTGAGTCTGATGAAGATGGCAG
CTGTTATCGAGAACTCTGCTAAAACCGGAGCAGTAGTTCTTGAACTTAGA
GGCAAGTTAACGGACCAGATTGAATGGCTTCCTGTATCAATTGGAAAATT
GAAGGATGTTACTGAATTGAACTTATCTGAAAACCGTATCATGGCTCTTC
CATCCTCTATTGCTGGAATCAAAACCTTAAAAAAGCTTGATATCCACT
back to top