CN189114

Overview
NameCN189114
Unique NameCN189114
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length715
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN189114_ssr41 microsatellite CN189114_ssr41:41..52. BLAST: Citrus ESTs to Prunus persica proteins V1
Libraries
Library NameType
Washington Navel Orange Stored Fruit Rind cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS06_0001F11_r Washington Navel Orange Stored Fruit Rind cDNA Library Citrus sinensis cDNA clone CS_WEc0001F11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN189114 ID=CN189114|Name=CN189114|organism=Citrus sinensis|type=EST|length=715bp
TTTTTCAATACCCATTTTCTTCTTCTTTAACAGAATCACACTCCTCCTCC
TCTTCAACCTCACCACAACACAAAGACAACCGTAAAATCCTTTTTTTAAT
CCTTTTTTGTGTTGTATAAATACATACATAACTGAGCAAGCGCTTGAAGC
TTTGTGTTTCTTTAAGCTAGTGAGTATTTTGCTTGTTACCCAGGGGGAAG
CTCCAGCTTTCATTGTGGATAATCTGCAGAATGGTAATGGATTTTCAAGT
GGCTTTAGTTTAAAGTCCAGAGACTGTGAAACGACCACTGTCATTGGTGA
CAAAACTTATGTCATTGCTGGGTCTGATGAATCAGTTGAAGTTAAGATTT
ATGACAGATCTACTGGAAACTGGTTGATTCCTGCTGTGCGGGGAATAGAG
CCCAGGCCATGTAAAGGCCATTCAGCTGTACTTCTTAATGAAGACCGAAT
TTTGGTTATCAAGAAGGGTTCAAGCTCAGATGACTGCCTTTGGTTTCTCG
AGGTGGACACTCCATATGTTAGAGAGCAGAAGAAAGTGGTAGGGGCTGAG
GTTGTTGCCTGGAGTAAAGGTGTGATCGGCAATGTTGAGAAACCAGTTGT
TATTACTGGTCCTTCTGGAGTAGGCAAGGGTACATTGATATCAATGCTCA
TGAAGGAATTTCCATCCATGTTTGGATTCTCTGTGAGCCACACAACTCGT
GCCCCAAAGGCCATG
back to top