CN188951

Overview
NameCN188951
Unique NameCN188951
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length531
Alignments
Feature NameTypeLocationAnalysis
CN188951_ssr199 microsatellite CN188951_ssr199:199..219.
Csv1_Contig972 contig Csv1_Contig972:108..637. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Washington Navel Orange Stored Fruit Rind cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS06_0001B10_r Washington Navel Orange Stored Fruit Rind cDNA Library Citrus sinensis cDNA clone CS_WEc0001B10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188951 ID=CN188951|Name=CN188951|organism=Citrus sinensis|type=EST|length=531bp
CCCTTTAGAATCCACCTCGCGGCTGGATGAAATGCTCGAGATCTTTACAC
ACACCAATAACAATAATAAGATCCAAGAATCACACACAAGAAAGAGAAAA
ATAAAAATAAAAATAAACTCATTCTTCCCGCACTACCAATTTATACGGAC
ATACATAGCCCCATCATCCAGCCCCAACTTCTAAGAATTCTAAGATTGAG
AAGAAGAAGAAGAAGAAGAAAATAATTTAAAAGAAGCTGTAAGAGGAAGA
TGCGTCTAGTGGGTGGATGAGGTATGTAAGAAGCAGAGCCACCAGCTTCA
GCAAGTACGCGATCCCTTGGTCGATTGATGTTCCATCGCTAGAAGGGGCA
GGAGCAGGTACAGTCGCAGGAGATTGGGCTTCAACTGCAGGAGAGGCTAT
GGCGAGTATAAGACCCAAAAGTGCCAAGAAGCAGACAAATACTCTTGATG
TAATAACCTCCATTTTTCTTGATTCTTCTCTCTTTTAATATTTCTTTTTT
TCCGACGAATTCCAGTAATATTTTGACTTAA
back to top