CN188942

Overview
NameCN188942
Unique NameCN188942
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length699
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN188942_ssr68 microsatellite CN188942_ssr68:68..77. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig4859 contig Csv1_Contig4859:1582..2279. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Washington Navel Orange Stored Fruit Rind cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS06_0001B06_f Washington Navel Orange Stored Fruit Rind cDNA Library Citrus sinensis cDNA clone CS_WEc0001B06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188942 ID=CN188942|Name=CN188942|organism=Citrus sinensis|type=EST|length=699bp
TTTTTTTTTTTTTTTTTAGCGGAGAAGGGTACAAATACAATAAAGCCATT
ATTTTCAGATTATTTACATATATATATGTACAACTCTGTCTCCTAATCAT
GGACAGAATTTGTTTAGCAAAGTATCAGATTACAGTCAACCTTGCCCACT
TCATGTGAAAACACTGCCCTATTAGTTTAAATATCAGTGTAATTCACATG
ATCTGCAATCTGTTAGTGTTTTAGGAGATACACCAAACCTATCCAGGTGG
AATTATCTGGCAGCTGCAGTTGCAGGAACCCCTTCTCTGAAGATAATATT
TGCAACTGGTGAGGGAAGCCAAGCTCCATTGCCACCAGCAGCCTGGCCAT
CCTGACAATTGTTGCCACCCCTCTTGGAATTCCCGTGGCCCTTCTTCAGT
CTACCACCCACGCTTCGTCCAACTAACCAGCCCAGTTTCATGGCTGCAAA
TAAACCCAGTGCAATTGCAAGTGGTCTCACAGACCAGTGGTAATCCTCGA
TATGTTTATACTTCTCCACTACACCAGGACAAGTATCAAAAGAAACAAGT
TCCACTTCGGATGGATCCGCCAAAGAGCTGCCAGATCCATGCCCTAATGG
GAATCTCCCTGGAAACCCAACAACAAGGCACCCATTTGGAAGCACTTGCA
AAATCTTCCCAGTGGCCCATTCTCCTCCTCTCTTACGAGGCCACTCAAA
back to top