CN188939

Overview
NameCN188939
Unique NameCN188939
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length753
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN188939_ssr455 microsatellite CN188939_ssr455:455..472. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig2691 contig Csv1_Contig2691:1..753. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Washington Navel Orange Stored Fruit Rind cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS06_0001B04_r Washington Navel Orange Stored Fruit Rind cDNA Library Citrus sinensis cDNA clone CS_WEc0001B04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188939 ID=CN188939|Name=CN188939|organism=Citrus sinensis|type=EST|length=753bp
GCGGTTACAGCTCAAGTGCTCTGCTAGCAAGCTCCTCCAGCGACTGCTAA
CGCAATCGCCGTGGCATCAATTGGAGGAGCTCAAGACGGTGGTGCTGCTG
CTTCTGATGTCGGTGGTGGTGGCTCGAATAATTCAGCTACTGAAGAAGAT
AAAGCGGGACGAAACGATGACGGTGACCGTAGTTTTGGTGGTAACCGGTG
GCCTAGACAAGAAACTTTGGCCTTGTTGAAGATACGTTCTGATATGGATC
AAGTGTTTAGAGACTCCAGTCTCAAAGGTCCATTATGGGAAGAGATTTCC
AGGAAACTAGCTGAGCTTGGTTATAATCGAAGTGCCAAGAAATGCAAAGA
GAAATTCGAGAACGTCTACAAATACCACAGGAGAACAAAAGATGGCCGCA
CGGGAAAGCCAGAAGGCAAGCATTACAAGTTTTTTGATCAATTAGAAGCC
CTTGATCATCATCATCATCATCATTCAATCGCTCCTCAAGCAACAACAAA
ACCTCAAGCTCCGTTAATGCAAGCAATTCCATGGACTATGAATCCTCCGA
GTTCAGTCCCGGCTCATATCAAGAATGTTGTTACATCAATATCAGCCGCA
AACCCTATACAAGCCGTGCCTCAGAGCACTGTCATTGCCCCTCCCACAAA
CCCTACGGTTTCTGCAGCAGCAGCGCCGCCATTAGCCCAGCCTGTGAATA
ACTTACCGTATTCGTTTGCAAATGTGTCGCCGAATCTTTTCTCGAGTTCA
ACA
back to top