CN188938

Overview
NameCN188938
Unique NameCN188938
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length591
Alignments
Feature NameTypeLocationAnalysis
CN188938_ssr363 microsatellite CN188938_ssr363:363..374.
CN188938_ssr376 microsatellite CN188938_ssr376:376..385.
Libraries
Library NameType
Washington Navel Orange Stored Fruit Rind cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS06_0001B04_f Washington Navel Orange Stored Fruit Rind cDNA Library Citrus sinensis cDNA clone CS_WEc0001B04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188938 ID=CN188938|Name=CN188938|organism=Citrus sinensis|type=EST|length=591bp
TTTTTTTTTTTTTTTTTGGAAGCTGCAAGTAAATATTCTGAATTCAATCA
AAAACAAACACTACAAACCATTTTCCCCCTTTACAAGTAACAGCCGACGA
ACAGAAATGAAAGATACAACCCCGAAGGTTTACTTTTCTTTATTAATAGG
GGCGGGAAAAAACTCAGCTAGCTATCTGCCTATGAACAGACTGAAAAATT
GGGAAAAAATTAAAAAAAAAAAAAAAGGGGCAAATTAAGCTAGAGCCATA
GTTTCTTTAAAAATTTTTCTATTCAACGGGTCTTTCCCCACCATGGATCT
TTCTCAGCCCCCCCCACTTTATTCTGATTCCTCTAAAAATTAAAAAGCAA
AATCAATAGAATTATATATATATAGATATATATATAAAGGAAAAATTAAT
CCCCCTATAAACTACAACCCACGGGGAAGTACCCCCCAACCTAACTTCAG
GGATATTAAAATCTTGGCCAGCATCTTAATTCATCAAGTTCGAACACACC
CCCCTGAAAAATTTAAAAATTAAAATAAACATTACCCCCCGTCTTTTAAC
CGCAATGAAAAATTTTCACAGAAATGAATTCACAGTTTTGG
back to top