CN188903

Overview
NameCN188903
Unique NameCN188903
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length767
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Washington Navel Orange Stored Fruit Rind cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS06_0001A04_f Washington Navel Orange Stored Fruit Rind cDNA Library Citrus sinensis cDNA clone CS_WEc0001A04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188903 ID=CN188903|Name=CN188903|organism=Citrus sinensis|type=EST|length=767bp
TTTTTTTTCCAAAAACCAGCATAACTTCATTTCCTCACCCCGCTTCCATC
AAAAAAATCTTCACGCAACAACTAGGTTTGTCTAAATGATGATATTAACA
TTATAATTTAAACTCATTCTTTCCCTTCTGGATAATGAGGACTGCAAATG
CTTAGATACACGCCAAAACACAACACATCTTCAGGACAAGTATACTTCAA
CACTTGCCGTCCTCATTGCCTTGCAGACGGGACAAACGCCTATAAGCCCT
TCACAGTCTTTACACAAACACAAGTGTCTGCATGGCAAAAGCAATATAGA
GACTTCCTGGATGTTACACGCTCTACAAATCATCTGCATTTTCATGGAAC
TTGAATTTCCAGAACCATCTACAACACTCAGATAATTCAGATTAGTGCGA
GACGCAGCATCGTCTACCTCACTGTCTCCACATCCCTCCTTCACATGCAA
AGAACCTTGTGCCATGGCCTGCTTAAGATTGTTCTTCAATGCATTGACTA
CAGACTCGTTATATTTTGCTTTGTAGTGCCAAGATTGAACTTCCATGCTA
ACCTGCTTTATTTTTTCCACTAGTTCCTTGTTCTTGCAGTTCATGACCTC
TATTTCCATCTCCTTTCCATGTAGCCTCCTTCCAACTTCTTTTTCTATGG
CACTGAGAAAAGAATATGTGTGTCTTTGCTTCATTTCCCTTACACCCTTT
ATCAAGTTTCCTTCCTGAATTCTCACGTACTGATCGAATTCTTCCTTCTG
ACGGCCAATCTCCAATT
back to top