CN188890

Overview
NameCN188890
Unique NameCN188890
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length771
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0006P16_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0006P16, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188890 ID=CN188890|Name=CN188890|organism=Citrus sinensis|type=EST|length=771bp
TTTTTTTTTTTTTTTTTGCGAATACGAATATTATAAGCCTTGAACCATTA
CAAGTTTCTGTATCTGACTCTATGCCTTGTTCCTGTAGCAAAGAAAATAA
ATTCATTTAACAACATTACAAGCTCAATCACAAACAGGGAAACGACCTGG
TTAGGACGGCCACAGTGGAAACCTCCAAAATAATCATGCCATTCTGAATC
ATCTCATAATCATACTTGGTTAATTTCAAATTGAATATGCATAAATCGCA
AGACTATATTTGATGGTGAATGATTGCCCACTAATCTTTAGCATATACTT
AACAAGCAAAGATGCAATCACTTCTCTTTGAACAGACTAGACAATAAAAG
TCCGTTCTTTTTTTTATTGTCTGCTCTCTTCTGTTTATCTCGCTTCTTAT
TAGTTCCCTCTGTTGATAATGAATGACGGTCTTTCTTCTCTAAGATCTTT
TCAGGATTTACCTTTATCTCTTCTTCAGGTGATTGACACGTCTTGGCTGC
CTTCTGGGTTTCCTCACCAAGCTGCTGGCTCCCCTCTTTTTGAACCAACT
CCTCATTAATAGATAACTCTTGGTCGAAGTGACAGGAATTCTCAATCCAC
TTGTGCTTCTCAGTTGTTCTCACCTTTAGTTCTTTGTCTGGTAATTGACA
ATTTTTGACCGCCTTATGGATTTCCTCAACCTCCTCTTTCGGAACCACAT
CCTCCTTGTTCATGGATAGCTCGTGGTTGATGCTGCTGAATTTCTCAGTC
CACTTGCACTTTTTTGGCTGT
back to top